Free PDF Downloads
98 documents-
Open PDFby C Roth · 1985 · Cited by 23 — the VH sequences of Ab1 anti-GAT monoclonal antibodies. The same type of results has been found with the Ab' it light chain variable region (VK) sequences.Vk Publications Gat
-
Open PDFby J Ruf · 1983 · Cited by 29 — BALB/c anti-GAT antibodies (8) suggested the conservation of a common set of anti-GAT-associated VH and VK germ-line genes. The publication costs of this ...Vk Publications Gat
-
Open PDFby C Tonnelle · 1983 · Cited by 23 — The synthetic random terpolymer (Glu ° Aia 3° Tyrl°)n (GAT) 1 elicits, in a number of inbred strains of mice, anti-GAT antibodies that can be characterizedVk Publications Gat
-
Open PDFby W Engchuan · 2016 · Cited by 7 — Gene-set activity toolbox (GAT): A platform for microarray-based cancer diagnosis using an integrative gene-set analysis approach.Vk Publications Gat
-
Open PDFferent Vk gene family. Two antibodies express com- mon Vk genes (0x1 and vk21c), whereas two other. Vk genes are unusual in BALB/c mice. One Vk gene.Vk Publications Gat
-
Open PDFby NC Bailey · 1989 · Cited by 42 — chain-variable region (VK) genes from various V gene fami- lies, suggesting that they donot derive from the pool of GAT precursors. Sequencing of VH and VK ..Vk Publications Gat
-
Open PDFGATE 2022 Computer Science and Information Technology Chapter wise solved ... New Delhi: G K Publication, 2022. ... Big Data and Hadoop by V. K. Jain.Vk Publications Gat
-
Open PDFby CM SORENSEN · Cited by 1 — specific suppressor T cell factor, termed GAT-TsFR, from genetic responder ... In a previous publication (6) we reported the apparent molecular weight of.Vk Publications Gat
-
Open PDFby LM Anders · 2021 · Cited by 3 — journals.sagepub.com/home/oed ... tonometry (GAT) is a commonly used method for IOP measurement although it ... Parihar JKS, Jain VK, Kaushik J, et al. Pars.Vk Publications Gat
-
Open PDFby G HUANG · Cited by 10 — matrix G yields an F-orthonormal basis {V1,V2,...,Vk+1} of block vectors Vj ... We note that the matrices L1 and L2 do not have to be square for the GAT and.Vk Publications Gat
-
Open PDFis publication as ... Journals Translated with Support by the National Science Founda- ... Temperature by V. K. Konyukhov, L. A. Kulevskiy, and A. M..Vk Publications Gat
-
Open PDFgct gtg gca act ggc gcc aac ccc gta gac ctt aaa. A M A. A V V ... V K ttt gcg ccc gac atc gat ctg gag act gtg gac gtg aaa.Vk Publications Gat
-
Open PDFJun 8, 2022 — and several other recent publications. A team consisting of Energy ... Crewe, G.F., Gat, U., Dhir, V.K. " Alkaline Solution Decaking of.Vk Publications Gat
-
Open PDFPrior Publication Data. US 2009/0117095 A1 May 7, 2009 ... TGT GCG AGA GGC TTC CCG GAT ACA GAT GTG ATT AAG CGC TAC TAC AJ239333 CLL ID 47.Vk Publications Gat
-
Open PDFby GJ Phillips · 1987 · Cited by 24 — (Received for publication, August 22, 1986) ... The costs of publication of ... CAA TCT ACC TTT TTG TTT CAC GAT TAC GAA ACC TTT GGC.Vk Publications Gat
-
Open PDFbook on the topic of deep learning on graphs, there are books on the general ... can partition the set of nodes V into K disjoint subsets V1,..., VK.Vk Publications Gat
-
Open PDFOct 25, 2019 — Sullivan's response “stunned gay rights activists, said Rohert ... OutWeek, a gay and lesbian magazine, ... aOOFATWII S n V K t FUND.Vk Publications Gat
-
Open PDFPER/BIO. The Good Books Co. 17/A3. 337 Gay Hellier ... 531 United Nations Publications Land Reform. SOC. United Nations, Dept.of ... 2626 V.K. Narasimhan.Vk Publications Gat
-
Open PDFConclusion: Our study found poor correlation and agreement between ICT and GAT. Based on our study results and previous publications, we can.Vk Publications Gat
-
Open PDFInternational Atomic Energy Agency. IAEAL. 07–00480. COPYRIGHT NOTICE. All IAEA scientific and technical publications are protected by the terms.Vk Publications Gat
-
Open PDFby RK Amplayo · 2018 · Cited by 16 — Ïr(vi, vk)vk Uk. Finally, we construct a weighted gate vector wk and use it to fix the source sentence vectors using the equations be-.Vk Publications Gat
-
Open PDFby M PUPILL · 1989 · Cited by 132 — encoding two Ga protein subunits from Dictyostelium. The ... The publication costs of this article were defrayed in part by page charge.Vk Publications Gat
-
Open PDFby AV Patchev · 2007 · Cited by 26 — S. S., Götz, F., Gehin, M., Chambon, P., Patchev, V. K., ... and P3 (CCC CTG GAT TGT TCC AAA GG]. The WT and ... Accepted for publication August 21, 2006.Vk Publications Gat
-
Open PDFB D Singh, Genetics, Kalyani Publishers. New Delhi. • Dr. P S Verma & Dr. V K Agarwal, Cell Biology: Cytology, Biomolecules and Molecular.Vk Publications Gat
-
Open PDFby S Sato · 1993 · Cited by 18 — 0 1993 Harwood Academic Publishers CmbH. Printed in the United States of America. DNA sequence of the glucosyltransferase gene of serotype d Sfreptococcus ...Vk Publications Gat
-
Open PDFJan 1, 2019 — INCLUDING BOOKS, SUPPLIES, AND INSTRUMENTS ... PLASTICS DIVISION OF INDUS ATLANTA, GA ... VK INTEGRATED SYSTEMS FULLERTON, CALIFORNIA.Vk Publications Gat
-
Open PDFLibrary of Congress Cataloging-in-Publication Data. Physics and chemistry of lakes/edited by Abraham Lerman, Dieter. Imboden, and Joel Gat;Â ...Vk Publications Gat
-
Open PDFbooks in connection with the use of children in pornography, primarily ... chiekenha\vk is an aVk Publications Gat
-
Open PDFby BLB Esporcatte · 2015 · Cited by 4 — luation, and Goldmann applanation tonometry (GAT) is the gold ... Submitted for publication: May 29, 2015 ... Suman S, Agrawal A, Pal VK, Pratap VB.Vk Publications Gat
-
Open PDF[18] Neeraj Kumar Misra, Subodh Wairya and V.K. Singh, “Frame of reversible BCD Adder and Carry Skip BCD Adder and Optimization using new reversible gates for ...Vk Publications Gat
-
Open PDFDec 6, 2018 — Graph Attention Networks (GAT) ... t-SNE plot of GAT-based node embeddings: ▫ Node color: 7 publication classes.Vk Publications Gat
-
Open PDFby D Kim · 2020 · Cited by 85 — proposed model, self-supervised graph attention network (SuperGAT). ... We use the public split by publication dates provided by the original paper.Vk Publications Gat
-
Open PDFby A Gruslova · 2012 · Cited by 37 — accepted for inclusion in Bioelectrics Publications by an authorized ... Modulating BK Channel Voltage Sensor and Gate" (2012).Vk Publications Gat
-
Open PDFMULTI-TECH PUBLICATION Multitechinique. 692 ARCHITECTURE OF INDIA ... VK Pub Bangalore ... GAY, P. Time Life books. 3288 AGE OF EXPLORATION. HALE, R J.Vk Publications Gat
-
Open PDFThe criteria presented in this publication should not ... Chapman, G.A. Unpublished data available at the National Water Quality ... 6-vk. post-.Vk Publications Gat
-
Open PDFby Y Leng · Cited by 5 — Graph Attention Network (MG-GAT)—learns latent user and business ... each edge between vi and a neighbor vk. ... New York, NY: SAGE Publications .Vk Publications Gat
-
Open PDFGay Johnson in Rawlins, and a number of other smaller ones, but I would just say those people represent the big share of gasoline diesel.Vk Publications Gat
-
Open PDFby CM Knudson · 1993 · Cited by 163 — (Received for publication, January 15, 1993, and in revised form, ... TCA GCA GTT GCC GTT GTT ATG TTT GAT TTA GTG GAT TAC AAA AAC TTT TCA GCA AGC TCT.Vk Publications Gat
-
Open PDFMar 26, 2007 — 1079 TAT AGC AAT ATA TGC GAA CGC TTG AGA AGC GAT GTA CAA ACG TCC TTT ... V K. 1968 CAA TTT GGA CTT ATA AAC GCA TTT CAA GTG AAG CAA TTG CAC ...Vk Publications Gat
-
Open PDFby AL Harris · 2009 · Cited by 5 — The two inferences drawn from these results, before publication of the crystal structure, were that the loop gate is located near the TM1/E1 border, ...Vk Publications Gat
-
Open PDFby L Yang · Cited by 13 — 0 when ank = 1, i.e., the nodes vn and vk are connected. Then, GAT can be represented as QGAT = OXW and con- sidered as a re-weighted adjacency matrix based ...Vk Publications Gat
-
Open PDFIt has been accepted for inclusion in Faculty Publications by an authorized administrator of LSU Digital. Commons. ... v, π0(ga−t)vK. 〉 = ˜f (gat KC) .Vk Publications Gat
-
Open PDFby VK Nandula · 2020 · Cited by 3 — Citation: Nandula VK, Giacomini DA, Ray JD. (2020) Resistance to acetolactate synthase inhibitors is due to a W 574 to L amino acid.Vk Publications Gat
-
Open PDFby H Wang · 2010 · Cited by 626 — gate-voltage dependent conductance shows hysteresis depending on the gate sweeping rate/range. ... Joshi, P.; Romero, H. E.; Neal, A. T.; Toutam, V. K.;.Vk Publications Gat
-
Open PDFV K Manglik, Elements of Mechanical Engineering, PHI Publications, 2013. 6. Hajra Choudhry S K, Elements of Workshop Technology, Vol 1 and 2, 2009.Vk Publications Gat
-
Open PDFThe Genetic Basis for the GAT Idiotypic Cascade 15. In the BALB/c Strain 15. The Abl and Ab3/Abl' Are Encoded by the Same VH and Vk Genes 15.Vk Publications Gat
-
Open PDFby L Zhou · 2018 · Cited by 147 — http://www.ieee.org/publications_standards/publications/rights/index.html for more ... V K = {g, gat−1 , ททท ,ga1 ,gscore ,gb2t−2 ,gb2t−3 , ทททVk Publications Gat
-
Open PDFby T Fulpius · 1994 · Cited by 25 — the heavy (VH) and the light (Vk) were determined by the ... TAC ACT CCA GTC CCT GAT CGC FC ACT CCC AGT GGA TCT GGG ACG CAT TTC ACT TTC ACC ATC AGC AGT GTG.Vk Publications Gat
-
Open PDFby J Silver · 2018 · Cited by 26 — ... license for the first six months after the publication date (see http ://www .rupress .org ... linker barcodes with the primers P5-CS1, 5′-AAT GAT ACG.Vk Publications Gat
-
Open PDFby W Lehnert · 1977 · Cited by 2 — Q: How fat is New York from Boston? ... (Nar did not gat the book from Sae e) ... Vk . Focus Rule. #2: FOCUS rAms . (. VARIATION OVER EXPECTATION.Vk Publications Gat
-
Open PDFby CY Chou · 2012 · Cited by 25 — ments in post-PK eyes taken using GAT and 3 contemporary, alternative instruments to measure IOP (TonoPen XL,. Accepted for publication Aug 4, 2011.Vk Publications Gat
-
Open PDFnications Publications; (4) Airspace Control Plan ... GAT. (1) Government Acceptance Test; (2) Guidance, ... VK. Cambodia (now Kampuchea).Vk Publications Gat
-
Open PDFHe is the author of four books and editor or coeditor of six others. Among them are the textbooks The. Sociolinguistics of Society (1984) and The ...Vk Publications Gat
-
Open PDFMar 8, 2022 — and/or may constitute a violation of South Gate Municipal Code Section 1.04.110. ... (2) The books and accounts, files, and other records of ...Vk Publications Gat
-
Open PDFState catalogs currently available may be purchased in paperback book fonn and are priced as follows: Alaska, $3.50; Arkansas, $1; California, $4.75; Colorado, ...Vk Publications Gat
-
Open PDFPart of the books for classes 6, 7 and 8 is bonus feature – a glossary of grammar terms for instant reference. Each book is complemented by worksheet sets ...Vk Publications Gat
-
Open PDFby K Xu · 2018 · Cited by 1019 — Graph Attention Networks (GAT) (Velickovic et al., 2018) ... p) to y (vk ... Processing Magazine, 30(3):83–98, 2013. Tang, J., Qu, M., Wang, ...Vk Publications Gat
-
Open PDFby LTP TOT — Reference books: a. ... Basic concept & metabolism of carbohydrate, protein & fat. ... Books: 1. Introduction to Visual Optics, Alan H. Tumadiffe(1987).Vk Publications Gat
-
Open PDFG. A. Thomas, The Chernobyl Tissue Bank: Integrating research ... S.W.H., S.J.S., Y.M., V.K., M.Y., O.L., M.J.M., V.D., A.B.d.G., G.A.T.,.Vk Publications Gat
-
Open PDFfat, carbohydrate, and protein as contributors to the total energy intake. ... of scientific publications, most of the recommendations from the 4th edition.Vk Publications Gat
-
Open PDFby P Rai · Cited by 6 — emphasize through research and publication by its faculty and through the character ... Goyal, V.K. Legal remedies & counselling in family: Disputes. Nyaya.Vk Publications Gat
-
Open PDFby D Yao · 2022 — TrajGAT can capture the long-term dependencies of trajectories ... a graph attention(GAT)-based Transformer is designed to encode ... k,ℓ, Kk,ℓ, Vk,ℓ.Vk Publications Gat
-
Open PDFFor a hard copy book: No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, ...Vk Publications Gat
-
Open PDFby M Berezovski · 2020 — Publications by an authorized administrator of Scholarly Commons. ... Gk+1 = Gk + vk. gAt. (18). Then we can choose the fixed grid cell ...Vk Publications Gat
-
Open PDFENGINEERING MATHEMATICS (BOOKS FOR GATE IES PSU's TANCET AND. OTHER GOVT EXAMS) ... ADVANCED MACHINING PROCESSES BY V. K. JAIN.Vk Publications Gat
-
Open PDFby JK Raina · 2020 · Cited by 7 — GA = 310, 233 & 77 bp. AA = 310 bp ... 5′- TGT TCC AGA CAG TTA GAT GAA AAT C-3′ (F) ... We give consent to BMC Cardiovascular Disorders for publishing our.Vk Publications Gat
-
Open PDFby R Charney · 2019 · Cited by 21 — one year after the publication date of the Version of Record. ... T ∈ S∆, where gAT and hAT are joined by an edge if and only if gAT ...Vk Publications Gat
-
Open PDFby P Mijares · Cited by 113 — an editorial on the same subject, entitled “Manila-Gate.â€) ... would desist from publishing my book on martial law; and 3) That I would.Vk Publications Gat
-
Open PDFUnimax Publication Jal. D.R.Sharma,Dr.Satinder. Pall,M.L.Sharma. D.R.Sharma,Dr.Satinder. Pall,Anil Makkar. M.M.Jindal,R.K.Sawhney,Bha gat Singh.Vk Publications Gat
-
Open PDFApr 1, 2022 — jk"Vªh; vk;qosZn l ... Jorawar Singh Gate, Amer Road, Jaipur-302002 ... The scholars with good number of publications in peer reviewed ...Vk Publications Gat
-
Open PDFPrior Publication Data ... Report," NIH Publication # 03-5432, pp. ... BONT G LYTRDTILIQVENNYISNISSNAILSLSYRGGRLIDSSGY GAT MNVGSD VI FNDIGN GO FK LNNSEN.Vk Publications Gat
-
Open PDFPublications of the World Health Organization are available on the WHO website ... a. cip, ciprofloxacin; gat, gatifloxacin; lvx, levofloxacin; mox, ...Vk Publications Gat
-
Open PDFCarbohydrate, Fiber, Fat, Fatty Acids, Cholesterol, Protein, and Amino Acids. ... heterogeneous and limited in number, and publication bias may be present.Vk Publications Gat
-
Open PDFKorean Board on Books for Young People (IBBY Korea) ... collection of the Korean children's books recommended by the book ... -jeol-nal-man Gat-a-ra).Vk Publications Gat
-
Open PDFby J Aspnes · 2004 · Cited by 6 — a bonus, we usually get functions (“f(x) = the number of books George ... know that some such j exists because, if nothing else, vk = vl.Vk Publications Gat
-
Open PDFby N Wang · 2003 · Cited by 8 — trade names in this publication does not imply en- ... gat ed genotypes of spearmint and peppermint ... Sharma, V.K. and J. Nowak. 1998. Enhance-.Vk Publications Gat
-
Open PDFby C Zhang · 2019 · Cited by 509 — Publication rights licensed to ACM. ACM acknowledges that this ... gate feature information of neighboring nodes, which makes the.Vk Publications Gat
-
Open PDFby VK Carpenter · 2012 · Cited by 37 — Please cite this article in press as: Carpenter, V.K., et al. SLC7 amino acid transporters of the yellow fever mosquito Aedes aegypti and their role in fatÂVk Publications Gat
-
Open PDFby M Ishibashi · 2013 · Cited by 258 — GAT-3'). Cell lines. HepG2 cells, human liver cancer cells, were provided ... Subramanian A, Tamayo P, Mootha VK, et al: Gene set enrich-.Vk Publications Gat
-
Open PDFby L HUGHES · 2007 · Cited by 22 — invasion (submitted for publication by Hughes L, Malone C, ... P1 5' CTG GAT TGT CCG GAA TTC AT 3' ... P2 5' GGA GAG AAC AGA GTT ATG GTA TGA A 3'.Vk Publications Gat
-
Open PDFl'esclavage, est l'Fat ou la condition d'un individu sur lequel ... exchange activities, for financing the translation, publication and distribution.Vk Publications Gat
-
Open PDFby A Bourne · 2013 · Cited by 34 — Keywords: Sexual health, HIV prevention, Gay and bisexual men, Best sex life. Background ... Many of these publications seek to.Vk Publications Gat
-
Open PDFMay 14, 2003 — All technical data contained in this publication is subject to the export control laws of the ... MOS Gate Capacitance Model Parameters.Vk Publications Gat
-
Open PDFK.A. Gschneider, Jr., V.K. Pecharsky, and A.O. Tsokol, “Recent developments in ... http://www1.eere.energy.gov/geothermal/publications.html.Vk Publications Gat
-
Open PDF8) Indian Economy; Mishra S.K. & Puri V.K., Himalaya Publishing House, ... Visit to not for profit concern Library,Sports clube mahila bachat gat,Public.Vk Publications Gat
-
Open PDFby VK Nandula · 2020 — V. K. Nandula et al. DOI: 10.4236/ajps.2020.118085. 1207. American Journal of Plant Sciences. Keywords. Amaranthus palmeri, ALS Inhibitors, ...Vk Publications Gat
-
Open PDFby SB Mitta · 2020 · Cited by 40 — ACCEPTED FOR PUBLICATION. 15 October 2020 ... Published by IOP Publishing Ltd ... currently in the research stage consist of thick gate-.Vk Publications Gat
-
Open PDFNOC AOG GAT GAT GAC ACC CAC CUT CAC COCTAT GAA 000 OOT GO OCC TAC AND GOT TTC ... publication on sequencing of the pel gene from strain SCRI193.Vk Publications Gat
-
Open PDFabled by the use of high-κ/metal gate stacks. LaLuO3 and HfO2 are investigated as two different high-κ oxides on silicon in conjunction with TiN as the ...Vk Publications Gat
-
Open PDFby P Chinnasamy · Cited by 23 — Please direct inquiries and comments to: IWMI-Publications@cgiar.org ... and France-Lanord 2002; Mazor 2003; Dickin 2005; Mook 2006; Rao 2006; Gat 2010;.Vk Publications Gat
-
Open PDFThereafter, within a week, all the answer books along with the ... Rai, V.K. (1993): Water Resource Planning and Development, Deep and Deep Publication,.Vk Publications Gat
-
Open PDFthe six books of the. Practice of Medicine par ... and Cornea) consists of Medas (lit. fat) and there is the ... powders of Sa)ja-ba.vk mixed with.Vk Publications Gat
-
Open PDFThe publication costs of this article were defrayed in part by page charge payment. ... GGCAGCCAGCTTCTGCTCACTCCAGGCACAGCC ATG GGA GAT TCG GAG ATG GCA.Vk Publications Gat
-
Open PDFAllen, J. D. , & Rainbow Support Group. (2003). Gay, lesbian, bisexual, and transgender people with developmental disabilities and mental retardation:Â ...Vk Publications Gat
-
Open PDFby B DuPont · 2022 · Cited by 2 — publication in the JOURNAL OF MECHANICAL DESIGN. Manuscript received March 10, ... (GAT) [63], and graph isomorphism network (GIN) [64]. For an.Vk Publications Gat
-
Open PDFFeb 13, 2008 — Prior Publication Data ... A L G CL V K ... 190 CAG AAA CCA GGG AAA GCT CCT AAG CTC CTG ATC TAT GAT GCC TCC AGT TTG GAR AGT GGG GTC.Vk Publications Gat
-
Open PDFby Z Khodaii · 2022 · Cited by 1 — ACA CAG CTG GAT GCA AAC CTG CAA AAC TCC AGC TTC GGC CTG TCG. miR-224 ... M.G.Z., M.G., and V.K.: sample processing and data analysis. T.A. and.Vk Publications Gat
-
Open PDFPeer-reviewed publications. Accepted ... Vigneau S, Johnson BE, Corcoran RB, Sharpe AH, Kuchroo VK, Ng K, Giannakis M, Nieman LT,. Boland GM, Aguirre AJ, ...Vk Publications Gat
Books
1 found📚 Search 5 Million+ Books
Compare prices from Amazon US, UK, India, Canada, Germany & France.